DNA analysis and sample sequences

Here’s a link to the UM download site for Lasergene/DNAstar. You’ll need your level 1 (Kerberos) login information.

Here are some test sequences that we will use:

Reference sequence:
GGAAACTGTGGTTGGGCAGATACAATATGGagacaagttagattcactatgctttacttcctatgaatgcaatgacacca
tatacgtgtgtcctagtatatgtgacatttatatgtaatattaagctcaaatttaaagtatccattgttcttttggaatc
tttcagtaatggaagtttattctttcacaggtatcacggttacatttatacataccgagtgtcccagacagaaacaggtt
cttggagtgctgaggtatagttgtatttatttttgcttctgggggt

Delfwd:
GGAAACTGTGGTTGGGCAGATACAATATGGAGACAAGTTAGATTCACTATGCTTTACTTCCTATGAATGCAATGACACCA
TATACGTGTGTCCTAGTATATGTGACATTTATATGTAATATTAAGCTCAAATTTAAAGTATCCATTGTTCTTTTGGAATC
TTTCAGTAATGGAAGTTTATTCTTTCATCAGTGTCCCAGACGGAAATCAGGTTCTTGGAGTGCTGAGGTATAGTTGTATT
TATTTTNGCTTNAAGGGGGT

Delrev:
ACCCCCTTNAAGCNAAAATAAATACAACTATACCTCAGCACTCCAAGAACCTGATTTCCGTCTGGGACACTGATGAAAGA
ATAAACTTCCATTACTGAAAGATTCCAAAAGAACAATGGATACTTTAAATTTGAGCTTAATATTACATATAAATGTCACA
TATACTAGGACACACGTATATGGTGTCATTGCATTCATAGGAAGTAAAGCATAGTGAATCTAACTTGTCTCCATATTGTA
TCTGCCCAACCACAGTTTCC

Insfwd:
GCGCATTACCCTCACTAAGGGAACAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGCCCNATNAAGCGGG
CTGCAGGAATTCGATTGGAAACTGTGGTTGGGCAGATACAATATGGAGACAAGTTAGATTCACTATGCTTTACTTCCTAT
GAATGCAATGACACCATATACGTGTGTCCTAGTATATGTGACATTTATATGTAATATTAAGCTCAAATTTAAAGTATCCA
TTGTTCTTTTGGAATCTTTCAGTAATGGAAGTTTATTCTTTCACAGGTATCACGGTTACATTTATCCCTCCCTACATACC
GAGTGTCCCAGACAGAAACAGGTTCTTGGAGTGCTGAGGTATAGTTGTATTTATTTTTGCTTCTGGGGGTAATCAAGCTT
ATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCG
TCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGC
TGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTG
TAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTC
CTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGG
TTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTG
ATAGACGGTTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTGGTTCCAAACTGGGAACAACACT
CAAACCCTATCTCGGTCTATTCTTTGAATTTATAAGGGATTTTGGCCGATTTTCGGGCCTATTGGTTNAAAAATGAGCTG
ATTTAACAAAAAATTTAACGCGAAATTTTAAACAAAANATTAAACGCTTTACAATTTTAGGNGGGCACCTTTTTNGGGGG
AAATGGGNNNCGGNAACCCCCNNNTTTTNTTTAATTTTTTCCAAAATANATTNCNAAATNTGTNNTCNGNCNCATGGAAA
ANAANNANCCCTNAANAAANGGCTTCCAATAAATATTGGAAAAGGGAANAANTTTGNNTTTTCCANCTTTCCCGGGGCCC
CCCCNTNATNCCCTTTTTTTNGGGGCAATTTGGCCTCCCGGGTTTTGCCCCCCCNANAAACCNTGGGGAAAAAAAAANAN
NNCTNAAAAANTNATTTGGGGGCNCAAAGGGGGTTTNANNCAANTNGATTNCAACCCGGGAAAAANCCNTGAAATTTNCC
CCCCAAAAAATTTTCAANGNAAAACCTTTAAAATCCTCTTTGGNGCGGGTN

Insrev:
GATTACCCCNAGAAGCAAAAATAAATACAACTATACCTCAGCACTCCAAGAACCTGTTTCTGTCTGGGACACTCGGTATG
TAGGGAGGGATAAATGTAACCGTGATACCTGTGAAAGAATAAACTTCCATTACTGAAAGATTCCAAAAGAACAATGGATA
CTTTAAATTTGAGCTTAATATTACATATAAATGTCACATATACTAGGACACACGTATATGGTGTCATTGCATTCATAGGA
AGTAAAGCATAGTGAATCTAACTTGTCTCCATATTGTATCTGCCCAACCACAGTTTCCAATC

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s